Humanities Writing Assignment Help. Humanities Writing Assignment Help.

(/0x4*br />

Directions: Respond to the assignment below. Be as clear and concise as possible with responses. Offer specific illustrations to support your opinions, observations, and concept applications.

Consider the following statement: It has often been said that the Greeks and Romans had more of a “here and now” view of life, whereas early Christianity focused on the “hereafter.” How is this reflected in Greco-Roman art as compared to early Christian art? Respond to this question in a 5 page essay. Cite at least two examples of painting, sculpture, or architecture from the Greco-Roman world and at least two examples of each from the early Christian world.

Paper Length: 5 word-processed pages, double spaced

Humanities Writing Assignment Help[supanova_question]

•Write between 750 – 1,250 words (approximately 3 – 5 pages) Writing Assignment Help

Employer of Choice (EOC)

After reading both of the weekly readings Employer of choice: the new corporate imperative and The Employer of Choice, identify two companies to compare and contrast in terms of EOC. The companies should be similar in size based on annual revenue or number employees, but do not have to be competitors or in the same industry. Also, address the questions below in your paper.

How the companies’ EOC policies and practices create advantages or disadvantages for their sustainability and growth?
What could the companies learn from each other?
Which company would you find more attractive as a potential employee? Why?

The requirements below must be met for your paper to be accepted and graded:

Write between 750 – 1,250 words (approximately 3 – 5 pages) using Microsoft Word in APA style, see example below.
Use font size 12 and 1” margins.
Include cover page and reference page.
At least 80% of your paper must be original content/writing.
No more than 20% of your content/information may come from references.
Use at least three references from outside the course material, one reference must be fromEBSCOhost. Text book, lectures, and other materials in the course may be used, but are not counted toward the three reference requirement.
Cite all reference material (data, dates, graphs, quotes, paraphrased words, values, etc.) in the paper and list on a reference page in APA style.

References must come from sources such as, scholarly journals found inEBSCOhost, CNN,onlinenewspapers such as, The Wall Street Journal, government websites, etc. Sources such as,Wikis, Yahoo Answers,eHow,blogs, etc. are not acceptable for academic writing.

[supanova_question]

Chapter 4 critical thinking analyzation Humanities Assignment Help

At the end of chapter 4, both the United States Air Force and Royston Paynter write about the UFO phenomenon and both author’s perspectives relate to how we should think about the concept of “evidence” in this controversial field. This gives us a good opportunity to take a closer look at this crucial topic in critical thinking.

Directions

In this assignment, make sure to read both articles and then CHOOSE one of them, and read it again closely and actively. Then, explain how you feel the author’s ideas relate to the concept of evidence as it has presented in this week’s materials. Do you think they make valid claims about evidence? Why or why not? In addition, be sure to identify and analyze any reasoning errors in the author’s argument.

PLEASE NOTE: This assignment is not asking neither for a summary of the articles NOR your perspective on the issue. Instead, in this assignment and many others, you will be doing an analysis of a particular article using the ideas and criteria specified by the assignment.

Criteria for Success

1, Knowledgeably employ the terms and ideas in the class materials and apply them to your given topic.
2. Skillfully and specifically analyze your given object of investigation.
3. Connect to your own experience and the world around you.

Assignment Expectations

For this assignment, you should not need to consult or utilize any outside sources. If you feel compelled to make reference to outside sources or other people’s words or ideas, you need to cite them using APA citation, or you may be committing plagiarism. (Please see APA information provided by your library, or contact either me or the librarian if you need clarification on APA citation).

Your assignment should be a minimum of 500 words (not including headers, references or other items not part of the main assignment text) and should be formatted according to APA specifications.

[supanova_question]

help with using baII plus to calculate answers Business Finance Assignment Help

12. Assume that a gallon of milk costs $2.99 today. If the average annual inflation rate over the past 30 years was 2.75% p.a., what did a gallon of milk cost 30 years ago?

13. What is the future value on the day of the last deposit of 25 annual deposits of $750 per year (first deposit to be made today) given an interest rate of 5.5% p.a.?

14. Assume that I deposit $750 into an account exactly 10 years from today. How much will be in my account at the end of year 50, assuming that my account pays interest of 4.5% p.a.?

15. What is the future value at the end of year 15 of $10,000 deposited today into an account that pays interest of 4.5% p.a., but with monthly compounding?

16. Walt is evaluating an investment that will provide the following returns at the end of each of the following years: year 1, $12,500; year 2, $10,000; year 3, $7,500; year 4, $5,000; year 5, $2,500; year 6, $0; and year 7, $12,500. Walt believes that he should earn an annual rate of 8 percent on this investment. How much should he pay for this investment?

17. Assume that Claudia started a paper route on January 1, 1970. Since that day, at the end of every three (3) months (first deposit made on April 1, 1970), she deposited $500.00 into a savings account, which paid her interest of 4 percent annually but with quarterly compounding. On January 1, 1980, she took the balance in her savings account and transferred it to an account that paid 11.5% p.a. Assuming that Claudia did not deposit any additional money into the account after the transfer, how much did she have in her account on January 1, 2014?

18. On the day that his first child was born, Ezio Auditore de Firenze deposited $3,000 into an investment account. The only purpose for the account was to pay for his son’s first year of college tuition. Assume that his son, Flavia, started college on his 18th birthday and his first year tuition payment had to be made that day. The amount needed on that day was $26,000. If that was indeed the amount of money in the account on Flavia’s 18th birthday, what annual rate of return did Ezio earn on his investment account?

19. Desmond Miles has $1,500 that he will use as a down payment on a car. Assuming that he can afford a payment of $225 per month, how much can Desmond spend on a car (that is, what is the total cost of the car that Desmond can purchase) if the interest rate is 5.75% and if he will finance his purchase with a 5 year, monthly payment loan?

20. Suppose you deposit $5,000 into an account earning 4 percent interest, compounded monthly. How many years (rounded to one decimal place – for example, 32.1843 year = 32.2) will it take for your account to be worth $8,500?

21. Suppose you deposit $5,000 into an account earning 4 percent interest, compounded monthly and you also make monthly contributions of $50 (first monthly contribution made one month after the initial deposit is made). How many years (rounded to one decimal place – for example, 32.1843 year = 32.2) will it take for the account to grow to $7,500 in this case?

22. Assume that I am trying to borrow money from you to finance my business. Assume that I promise to repay you in three installments, one payment of $5,000 to be made exactly 2 years from today, a second payment of $10,000 to be made exactly 5 years from today, and a final payment of $15,000 to be made 8 years from today. If your opportunity cost of funds is 7.5% p.a., (that is, use an interest rate of 7.5% for this question), how much should be willing to lend me today?

23. What is the future value at the end of year 25 of depositing $5,000 today, $3,500 at the end of years 1, 2 and 3, $5,000 at the end of years 4, 5, 6 and 7 and $4,250 at the end of years 8, 9, 10, 11 and 12 into an account that pays 9.5% p.a.? (No deposits will be made into the account after year 12).

24. If you wanted to fund a scholarship that would pay $12,500 per year forever at GSU, how much would you have to deposit today if you wanted the scholarship to start paying five (5) years from today? Assume the endowment could earn 6.25% p.a. interest forever.

25. You currently owe $20,000 on a car loan at 8.25 percent interest. If you make monthly payments of $596.59 per month, how long (i.e., number of months rounded to one decimal place) will it take you to fully repay the loan?

26. It is now January 1. You plan to make 5 deposits of $300 each, one every 6 months, with the first payment being made exactly six months from today. If the bank pays a nominal interest rate of 12% but uses semiannual compounding, how much will be in your account exactly 12 years from today?

27. You must make a payment of $3,800 exactly 8 years from today. To prepare for this payment, you will make 5 equal deposits into an account that pays a nominal interest rate of 7.6% p.a., with quarterly compounding. If your first deposit is made today (and then you make four additional deposits in each of the next four quarters – that is, a deposit 3 months from today, another 6 months from today and so on), what must each of the 5 payments be for you to exactly achieve your goal?

USE THE INFORMATION BELOW TO ANSWER THE FOLLOWING THREE QUESTIONS

Vito Scaletta just bought his dream car, 2014 Aston Martin DB9 that cost $208,700. He paid $35,000 down and financed the balance over 84 months at 6.25% p.a. (Assume that Vito makes all required payments on time).

28. What is the monthly payment on Vito’s loan?

29. What will the balance on Vito’s loan be at the end of the fourth year (that is, immediately after Vito makes his 48th payment on the loan)?

30. What is the total amount of interest that Vito will pay over the entire term of the loan (that is, the total amount of interest that is paid on payments 1 through 84)?

31. Today is your 30th birthday and you have a dream of retiring on your 65th birthday. You want to put aside however much is necessary on your 31st through 65th birthdays (35 annual payments) to have enough to retire. You’ve estimated that you will live until you are 90 and you want the first withdrawal to occur on your 66th birthday, with the last payment occurring on your 90th birthday. You think that you will need $150,000 per year to spend during retirement. You estimate constant interest rates of 11.25%. Assuming that you currently have $7,500 deposited in your retirement account, how much must you put aside each year in order to have sufficient money to retire at age 65?

32. John Keene recently invested $5,000 in a project that is promising to return 6.5 percent per year. The cash flows are expected to be as follows:

End of Cash

Year Flow

1 $1000

2 950

3 875

4 ???

5 850

Note that the 4th year cash flow is unknown. Assuming the present value of this cash flow stream is $5,000 (that is, CF0 = -5000), what is the missing cash flow value (that is, what is the cash flow at the end of the 4th year)?

33. You have a $25,000 balance on your credit card. You plan to make monthly payments of $450 until the balance is paid off. The interest rate on your credit card is 17.5% p.a., compounded monthly. A letter in the mail informs you that you are approved for a new credit card and balance transfers are subject to a 9.5% p.a., compounded monthly. How many months sooner will you pay off your bill?

[supanova_question]

java programming Programming Assignment Help

Please Have output in a word document with comments within the program!

The following two questions are closely tied
together, you need to first finish question #1 in order to do question #2.
Please write the data processing methods, such as codon() and codon2aa()
in a separate Java class, and the input and output in another class.

1. The genetic code of any organisms comprises of three
nucleotides, also known as codon. Many gene-finding programs rely on
translating a piece of DNA sequence in all possible reading frames and looking
for the longest non-interrupted region of translation. Please develop a Java
program to read in a piece of DNA sequence from a FASTA format sequence file (hwk3.seq) and
then print out all the codons in three forward reading frames. Design a method
called codon() that can
be used to find all the codons from three reading frames. The method will take
in an argument, the reading
frame (1, 2, or 3), and return an array or ArrayList with all the codons. All
the codons should have three nucleotides, please discard the last one if it
does not have three nucleotides. Below is a sample output of the program:

Please
enter the file name contains the DNA sequence:

hwk3.seq

The
DNA sequence is:

TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC

Reading
frame #1 codons are:

TCA
GCG AGA TGG GAA AGA TCA CCT TCT TCG AGG ACC GAG GCT TCC AGG

Reading
frame #2 codons are:

CAG
CGA GAT GGG AAA GAT CAC CTT CTT CGA GGA CCG AGG CTT CCA GGG

Reading
frame #3 codons are:

AGC GAG ATG GGA AAG ATC ACC
TTC TTC GAG GAC CGA GGC TTC CAG GGC

2- . Please add another method called codon2aa() to modify the previous
program (question #1) to print the corresponding amino acid beneath each codon.
Use a single letter representation of the amino acid, and a * for the stopping
codon. See below for a sample output.

Please
enter the file name of DNA sequence:

hwk3.seq

The
DNA sequence is:

TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC

Reading
frame #1 codons and amino acids are:

TCA
GCG AGA TGG GAA AGA TCA CCT TCT TCG AGG ACC GAG GCT TCC AGG

S
A R W E R
S P S S R
T E A S R

Reading
frame #2 codons and amino acids are:

CAG
CGA GAT GGG AAA GAT CAC CTT CTT CGA GGA CCG AGG CTT CCA GGG

Q
R D G K D
H L L R G
P R L P G

Reading
frame #3 codons and amino acids are:

AGC
GAG ATG GGA AAG ATC ACC TTC TTC GAG GAC CGA GGC TTC CAG GGC

S
E M G K I
T F F E D
R G F Q G

[supanova_question]

Reword the following: Science Assignment Help

Therefore,
it is important for the patient to get tested to ensure treatment is no delayed
and risk further complication. As the virus progress the illness associated
with it becomes more complicated and difficult to treat because without
treatment the immunodeficiency rises. “The majority of disease occurs in the
advanced stages of HIV infection where immunosuppression is the predominant
influence Hogan, C., & Wilkins, E., (2011).” Therefore for patient should
seek early treatment and adhere to medication regimen to decrease progression
of the infection and prevent further complication. Other issues that need to be
address is measures need to be taken for early testing, without being tested
many patient are able to transfer the virus from one person to another without
even knowing. Early diagnose of the disease will give patient the opportunity
to seek medical care and become knowledgeable of the step needed to take to
prevent them from infecting other individual. Several states have now implement
policies to test newborn babies for the HIV virus without permission of the
parents.

HIV
affect people from all different background, however group on minority continue
to be disproportionately impacted. This can be seen with majority of the
reported case in the United State are of racial and ethnic minority population.
A contributing factor to this problem, are lack of resources, high risk
behavior and unequal access to health care people for minority population.
Cargill, VA & Stone, VE (2005) HIV is a public issue that has caused
widespread epidemic infection and impacted people from all over the world. It
affects individual of all ages but are more prevalent in young people with
adolescents accounted for half of the 20 million new sexual infections reported
in the United State CDC.GOV (2014). Other factors that played a role in the
increase in HIV are the influence of an individual society; this include social
determinants of the individual such as, behavior, access to health care,
genetic, social influences and the person’s physical environment Maurer, F.,
& Smith, C.,(2013).

These
factors can have a significant impact on the individual’s health and the
development of illness. This is because of genetic predisposition factors and
certain risk behavior, also the disparity of health within population of racial
and ethnic groups that prevent the availability of education and resources to
fight HIV. One examples of this is problem with sexual assault on women in many
under develop countries; these women and children has no choice in the matter
there physical environment put them at risk and as a result many contracted HIV
and other sexually transmitted disease. Other issues include prostitution, drug
use involve the sharing of unsterile needles and lack education to implement
primary prevention. These issues are more prevalent in racial and ethnic
minority group and impacted health is responsible for influencing health in a
negative way.

Reword these few paragraphs so they don’t come up
plagiarized.

Reword the following: Science Assignment Help[supanova_question]

Research Paper Writing Assignment Help

Critical Analysis: Group Research Paper

Groups will research and critically evaluate the issues surrounding the Healthcare.gov website. This is a formal research paper. As such, you are expected to have a minimum of 10 sources, and the sources should meet criteria of information quality (e.g., are the sources Accurate? Valid? Reliable? Objective? Credible? Relevant? Complete? Etc.) Because this is a timely and ongoing topic, it is unlikely you will find many scholarly sources (i.e., reputable journal articles) but I encourage you to focus on sources that are not excessively biased. Do not give me a “Fox News” paper J

Papers should be approximately 15-20 pages, formatted using Times New Roman 12-point font with 1-inch margins, page numbers, double-spaced, with a title page that states the class, section number, title of the paper, and group member names. I do not care what citation style you use (e.g., APA, MLA), so long as you are consistent throughout the paper with the in-text citations and reference list.

Although this is not a formal case-study, a good approach to take when starting this paper is to review the Systems Approach (posted in your first iLearn Lesson). In short, you should provide:

· Introduction

· Summary of the relevant facts

o This will be the main portion of this research paper

· Definition of the problem as your group sees it

o There are several ways to address the problem(s) of Healthcare.gov. Your group should come to a consensus regarding what you consider the be the over-arching problem and present your research in a way that supports your problem statement.

o For this research paper, you could place the problem statement before the summary of facts if you want.

· Alternatives: what could have been done differently?

o This is a “hindsight” view, or “lessons learned” approach. If you were the project manager of Healthcare.gov, what could/would you have done differently?

· Conclusion

· References

Please be professional and do not make this a political paper. I do not care which side of the fence you vote on. Stick to the facts. Please keep in mind this assignment is to critically evaluate Healthcare.gov, not the Affordable Care Act (AKA, Obamacare)! It’s your job to flesh out the facts of this case and ignore the political banter. I anticipate this will be a very interesting assignment for you, and I am genuinely looking forward to reading your papers!

[supanova_question]

Research Paper Writing Assignment Help

Critical Analysis: Group Research Paper

Although this is not a formal case-study, a good approach to take when starting this paper is to review the Systems Approach (posted in your first iLearn Lesson). In short, you should provide:

· Introduction

· Summary of the relevant facts

o This will be the main portion of this research paper

· Definition of the problem as your group sees it

o For this research paper, you could place the problem statement before the summary of facts if you want.

· Alternatives: what could have been done differently?

o This is a “hindsight” view, or “lessons learned” approach. If you were the project manager of Healthcare.gov, what could/would you have done differently?

· Conclusion

· References

[supanova_question]

Locate and provide a citation(s) to your state statute(s) regarding a last will Business Finance Assignment Help

Assignment Introduction:

Due process is a term used to describe how matters move through the court system. The movement of a matter through the court system can be lengthy process, and probate is no exception. One way to speed up the process of asset transfer after death is to have a valid will that describes how assets are to be distributed.

This Assignment has three parts:

Locate and provide a citation(s) to your state (Illinois) statute(s) regarding a last will and testament. You do not need to include the text of the statute in your Assignment.
Locate a form that can help guide you to create a will that is valid in your state (Illinois). Be sure that it contains all of the requirements for your state (Illinois). Be sure to cite the source you used for your form on your reference page.
Draft a simple will using the form you found in the first part of this Assignment based on the following hypothetical situation:

You have a spouse named Casey Washington, a 28-year-old son named Taylor Washington, a 26-year-old daughter named Madison Washington, and a 24-year-old daughter named Allison Washington. You would like all of your assets to pass to your spouse first. If your spouse predeceases you, then you would like your assets to be divided equally among your children, per stirpes. You own the following assets:

A furnished house
Two vehicles [you choose which make and model]
Approximately $1,000 in a checking account
Approximately $10,000 in a savings account
A wedding ring worth approximately $3,000
A collection of baseball cards worth approximately $1,000

You may be creative with any other information not listed above that may be necessary to draft a valid will in your jurisdiction.

Required Criteria:

In addition to fulfilling the specifics of the Assignment, a successful paper must also meet the following criteria:

Length should be 4–8 pages excluding cover page and references page.
Double spaced and 12-point font.
Viewpoint and purpose should be clearly established and sustained.
Assignment should follow the conventions of Standard American English (correct grammar, punctuation, etc.).
Writing should be well ordered, logical, and unified, as well as original and insightful.
Your work should display superior content, organization, style, and mechanics.
Appropriate citation style should be followed.

[supanova_question]

governmental and non-profit organization accounting Business Finance Assignment Help

Identify two (2) strategies based on fiscal and monetary policy that would encourage people to spend money in order to create economic growth. ( 600 words )
what do you mean by balance of payment? elaborate with the help of suitable examples? ( 500 words )
what are capital projects and debt services? explain with help of suitable examples ? ( 600 words )

Must follow these formatting requirements:

Be typed, 1 1/2 spaced, using Times New Roman font (size 12),
Must be plagiarism free.
it is very important to write examples .
references must be provided.

Assignment Format :-

Introduction
Body of assignment
learning derived
Bibliography

[supanova_question]

Humanities Writing Assignment Help